Abstract

Background: Wounds are classified as acute and chronic according to their clinical course. Although chronic wounds are rare, they can lead to death due to delays in healing. In both types of wounds, colonization with gram positive and gram negative bacteria can be observed. The diagnosis of microorganisms and antibiotic susceptibility profiles are known to be very important in treatment.

Material and Method: Swabs were taken from patients diagnosed with chronic wounds in our hospital. The samples were subjected to isolation and identification methods for microbiological analysis. Phenotypic antibiotic susceptibility analysis of each isolate was performed. Target gene analysis was performed for Staphylococcus aureus and Pseudomonas aeruginosa strains.

Discussion: Acute and chronic wound wounds can cause significant health problems and even death. Especially chronic wounds may cause sepsis due to their delayed healing. Wounds can be colonized with hospital and community-acquired bacteria. Wounds can also be colonized with both gram-positive and gram-negative bacteria. In our study, colonization with S. aureus and P. aeruginosa was more common. Males were more susceptible than females.

Conclusion: The most frequently isolated strains from patients with chronic wounds were S. aureus and P. aeruginosa. These strains were found to have multiple drug resistance. It was observed that strains with resistance genes posed a serious risk. A good understanding of the profiles of hospital and community-acquired wounds is very important in terms of establishing the correct treatment processes.  

Introduction

The primary role of intact skin is to control microbial populations colonizing at the skin surface and prevent deep tissue from being colonized and invaded by pathogens (1). The exposure of deep tissue following the breakdown of skin integrity (i.e. the wound) provides a moist, warm and nutritious environment conducive to microbial colonization and growth. Since many microbes are involved in wound colonization and contain a large number of potentially pathogenic microorganisms, any wound is at risk of becoming infected (2). Common microorganisms associated with wound infection include Staphylococcus aureus (S. aureus), which causes 20-40% of nosocomial infection according to different studies. Pseudomonas aeruginosa (P. aeruginosa), which mainly causes infections after surgery and burns, has been reported to account for 5-15%. Other pathogens such as Enterobacteriaceae and Enterococci cause infection, especially in immunosuppressed patients and following abdominal surgery (3).

Chronic leg ulcers (CLUs) affect 1-2% of the population worldwide. They are a major cause of morbidity associated with delayed healing and high recurrence rates (4). CLUs particularly affect the elderly (over 65 years of age) and are associated with increased cost of diagnosis, treatment, care and rehabilitation (5). Chronic venous ulcers (CVUs) are the most common type of CLU (70% of cases). In addition, arterial ulcers account for 5-10%. Diabetic ulcers are mostly associated with a neuropathic cause and about 60% have an ischemic origin. Mixed venous and arterial ulcers account for 15-30% of all CVUs (6; 7). Physiologically, the mechanism of wound healing is associated with connections between fibroblasts, Langerhans cells, keratinocytes and endothelial cells (8). Furthermore, this mechanism is characterized by hemostasis, inflammation, proliferation and remodeling (9). In the chronic wound, active leukocyte cytolytic enzymes, such as matrix metalloproteinase (MMPs) (10; 11), free oxygen radicals and inflammatory mediators are released, causing a mismatch between pathological local factors. This environment allows the colonization of both Gram-negative and Gram-positive microorganisms (12), especially Staphylococcus, Pseudomonas, Enterococcus, Enterobacter and Finegoldia (13; 14). It is observed that 93.5% of CVUs are caused by Staphylococcus aureus, 52.2% by Pseudomonas aeruginosa, 71.7% by Enterococcus faecalis, 45.7% by coagulase negative staphylococci, 41.3% by Proteus spp. and 39.1% by anaerobic bacterial infections (15). In diabetic and arterial foot lesions, Gram-positive aerobic cocci were found in 59% of cultures, of which 24% were S. aureus. In addition, the percentage of Gram-negative aerobic cultures, which are frequently colonized by Escherichia coli and Proteus mirabilis strains, is 35% (16; 17).

S. aureus and P. aeruginosa represent the most common agents isolated from CLUs and form a type of biofilm that is often resistant to antimicrobial therapy (18; 19). S. aureus usually colonizes at the top layer of wounds, while P. aeruginosa colonizes at the deepest part of the wound bed. S. aureus is a common opportunistic pathogen that is highly susceptible to many antibiotics such as methicillin (20), although treatment has been complicated in recent years by methicillin-resistant S. aureus (MRSA). P. aeruginosa has high chromosomal and acquired antibiotic resistance (21), which makes it difficult to treat (22). A wound determined to be infected with P. aeruginosa is characterized by a significantly larger area and a delayed or inhibited healing process (4). De Leon et al. (23) reviewed literature data and found that the ability of P. aeruginosa and S. aureus to survive the antibiotic treatment was enhanced when they were grown together in co-cultures. Similarly, Pastar et al. (24) interpreted the interactive effects of MRSA and P. aeruginosa on wound ulcers in an experimental study of a porcine wound healing model, reporting that bacterial associations can alter virulence, prolong the healing process and alter response to antimicrobial therapy. Accurate diagnosis and treatment of leg ulcer infections requires detailed knowledge of skin bacterial epidemiology and risk factors for infection.

The aim of this study was to isolate S. aureus and P. aerugisa from patients who applied to Van Regional Training and Research Hospital with chronic wound ulcers and to evaluate the antibiotic resistance status of these strains.

Material and method

Bacterial isolation and identification analysis

Patients diagnosed with chronic wound ulcers were followed up between January 2020 and December 2021 at Van Training and Research Hospital. A swab sample was taken after the wound was washed with soap. The samples were taken to the laboratory for microbiological analysis in cold chain. For isolation, 5% sheep blood agar (Acumedia, USA), Mc Conkey agar (Oxoid, UK), Eosin Methylene Blue Agar (EMB, Oxoid, UK), Mannitol Salt agar, chromID® P. aeruginosa (bioMerieux) and chromID® MRSA SMART (bioMerieux) media were used. Catalase, oxidase and coagulase tests were performed. VITEK 2 device was used for identification and antibiotic resistance analysis of the isolated bacteria. Isolates were stored at -20⸰C.

Genomic DNA extraction and gene amplification

Bacteria were brought to the molecular unit of Van Yüzüncü Yıl University, Faculty of Pharmacy, Pharmaceutical Microbiology Laboratory for DNA extraction. The bacteria were cultured on Trypton Soy Agar (Acumedia, USA) and incubated at 37̊C for 24 hours. Then, DNAs of S. aureus and P. aeruginosa strains showing multidrug resistance were extracted using the EcoSpin Bacterial Genomic DNA kit (Echotech Biotechnology, TURKEY) protocol. Bacterial DNA samples were stored at -20̊C.

May TaqTM DNA Polymerase (Bioline, Bio- 21105) protocol was used for DNA amplification of bacteria. For Polymerase Chain Reaction (mPCR), 10µL 5x MyTaq reaction buffer (5 mM dNTPs, 15 mM MgCl2), 5µL template DNA, 1µL of each primer (20µM), 1µL MyTaq DNA polymerase and 8µL PCR water (ddH2O) were calculated as 25µL final solution. PCR conditions for MecA were set as 15 min at 94̊C, 30 s at 94̊C, 1 min at 59°C, 1 min at 72̊C, 10 min at 72̊C, for 30 cycles. MecA gene amplification for isolated and identified S aureus was performed using F: 5'- TCCAGATTACAACTTCACCAGG-3'; R: 5'- CCACTTCATATATCTTGTAACG -3' primer (25). PCR conditions for VIM and IMP were set as 5 min at 94̊ C, 1 min at 94̊C, 1 min at 54̊C, 2 min at 72̊C, for 30 cycles. VIM and IMP gene amplifications for isolated and identified P. aeruginosa were performed by using F: 5′-GTTTGGTCGCATATCGCAAC-3′; R: 5′-AATGCGCGCAGCACCAGGATAG-3′ and F: 5′- GAAGGCCGTTTATG- TTCATAC-3′; R: 5′-GTATGTTTTCAAGA- GTGATGC-3′ primers (26). HyperLadderTM marker (50 Base Pair, Bioline, USA) was used to evaluate amplicon sizes. Bacterial amplicon products were run on a 1.5% agarose gel in a Thermo EC300XL2 electrophoresis device at 100 volts for 1 hour. Amplicons were visualized using Bio-Print- ST4 (Vilber Lourmant, France). P. aeruginosa ATCC27853 and S. aureus ATCC297213 strains were used as controls.

Ethics Committee Approval

The ethics committee approval of our study was approved by the clinical research ethics committee of Van Training and Research Hospital with the decision dated 11/09/2020 and numbered 2020/04.

Results

Two hundred sixty-nine patients with chronic ulcerative wounds were microbiologically analyzed. 185 (69%) of the patients were male and 84 (31%) were female. After isolation and identification from these patients, all of the wounds were found to be contaminated with different microorganisms. It was determined that 47 (17.5%) of the wounds were mono-microbial and the others were poly-microbial. Of these wounds, S. aureus and P. aeruginosa were the most frequently isolated microorganisms in 81 (34%) and 55 (23%) wounds, respectively.

The analysis of S. aureus by Vitek II showed that the highest antibiotic resistance was found to Tetracycline, Erythromycin and Gentamicin. In addition, the highest susceptibility was found to Vancomycin. 17 isolates were determined to have MRSA phenotype. As a result of the analysis of P. aeruginosa strains with Vitek II, it was determined that the highest resistance was to Cefoxitin, Cefazolin and Cefepime. In addition, the highest susceptibility was found to Colistin. Furthermore, carbapenem resistance was observed among P. aeruginosa strains, although not very high. Information about the antibiotic resistance phenotype of both S. aureus and P. aeruginosa strains is given in Table I.

Genotypic analysis of S. aureus strains phenotypically identified as MRSA was performed. All MRSA strains were found to carry MecA gene. Among the 16 P. aeruginosa strains phenotypically showing carbapenem resistance, 7 of them were positive for VIM and 3 of them were positive for IMP genes.

Discussion

Healthcare professionals are responsible for wound management and care to ensure that wound infections are prevented or reduced. However, in cases where infection develops, wound management practices should be addressed in detail. In other words, wound treatment requires a systematic study from the analysis of the patient profile to the treatment process. Antibiotic treatment protocol is prepared, but antibiotic susceptibility testing should be performed first. The study by Mama et al (27), showed that the incidence of wound infection was higher in males (89.7%) than females (81.4%). This is in line with studies conducted in different parts of Ethiopia (28) and other countries (29). This may be explained by the fact that traditionally, men are predominantly involved in occupations such as farming, construction work, transportation and industrial work where trauma exposure is common. In our study, as in the studies mentioned above, wound infections were more common in men than in women.

In a study by Bessa et al. 28 microbial species were isolated from wounds with signs of infection. Most of the wounds were colonized by a single bacterial species. The most common isolate was S. aureus, which has been reported as the dominant microorganism isolated from different types of wounds in other studies (30; 31). In a study by Mama et al. (27) 91.6% of culture positive wounds showed mono-microbial growth, 8.4% showed poly-microbial growth and 12.7% showed no bacterial growth. Similarly, high rates of mono-microbial growth have been reported in India (86-100%) and Pakistan (98%) (32; 33). In our study, 47 (17.5%) of the wounds were mono-microbial and the rest were poly-microbial. Based on this, unlike the above studies, poly-microbial culture growths were found to be higher in our study. It is seen that P. aeruginosa is the most frequently detected Gram-negative bacterium according to the studies (4; 34). S. aureus and P. aeruginosa are known to produce highly destructive virulence factors responsible for maintaining infection and prolonging healing in chronic wounds. S. aureus causes clinically significant infections, mostly through virulence factors such as coagulase, catalase, clumping-factor A and leukocidins (35). Furthermore, elastase released by P. aeruginosa has been associated with pathogenicity in the wound environment (36). Therefore, our results confirm the usual most common microorganisms found in infected wounds. However, the role that each specific pathogen plays in both non-healing and infected chronic wounds is not yet fully defined; it is mostly based on hypotheses. Apart from the presence of pathogens, the presence of specific bacterial combinations and interactions is thought to be crucial in both acute and chronic wounds (37). In a separate study, S. aureus (32.4%) and E. coli (20%) were the main organisms isolated from wound infections (27). A number of previous reports on wound infection from Ethiopia and different parts of the world showed that S. aureus and E. coli were the most common isolates (38; 39). The high prevalence of S. aureus may be because it is an endogenous source of infection. Infection with this organism may also be due to contamination from the environment, e.g. contamination of surgical instruments. S. aureus, a common bacteria found on surfaces, easily colonizes into wounds when the natural skin barrier is disrupted. In our study, S. aureus and P. aeruginosa were the most common bacteria found in 81 (34%) and 55 (23%) chronic wounds, respectively. Compared to other studies, we have identified a possible bacterial profile in our patients.

Bacterial isolates were examined for patterns of susceptibility to the antibiotics most commonly used in treatment. Despite growing concerns about antibiotic-resistant bacteria, the appropriate use of systemic antibiotics is still recommended where there is clear evidence of infection (40). Resistance to oxacillin is particularly important because it can give us the percentage of methicillin-resistant Staphylococcus aureus (MRSA). In the study by Bessa et al., it was found that 21.8% of S. aureus was resistant to oxacillin. S. aureus has always been the main source of infection in acute soft tissue wounds. MRSA, however, has been an organism causing infection in only a small portion of the total. However, MRSA is recently becoming a more common wound pathogen (41). The emergence of MRSA presents two problems: first, it is associated with the chronic wound, which is the source of other MRSA nosocomial infections. Second, with the impact of MRSA on the chronic wound itself, there is an increased risk of bacteremia (41). Among Gram-positive bacteria, all isolates were susceptible to vancomycin and linezolid; no resistance was detected despite the massive use of these two antibiotics. According to the study by Mama et al. (27), S. aureus tended to be resistant to a wider range of antibiotics in the determination of the susceptibility of S. aureus to fifteen antibiotics selected by disk diffusion technique. In this study, S. aureus showed high resistance to ampicillin (95.7%), penicillin (91.5%) and tetracycline (51%). This was consistent with studies conducted in Ethiopia (42) and elsewhere (29). The same isolate was highly susceptible to amikacin (100%), vancomycin (100%), ciprofloxacin (96%), norfloxacin (96%) and gentamicin (96%). In addition, clinical Staphylococci were found to be 100% susceptible to vancomycin and (43) amikacin. In the study by Mama et al. coagulase negative Staphylococci were found to be 100% susceptible to amikacin and vancomycin, sulfamethoxazole trimethoprim (86%), gentamicin (83%) and ciprofloxacin (76.2%). The same organism was highly resistant to ampicillin (90.5%), penicillin (76%), cephalothin (71%) and tetracycline (52%). This finding was comparable to studies conducted in the same country (44) and elsewhere in the world (45; 46). The remarkable susceptibility of Gram positive bacteria to vancomycin, amikacin and aminoglycosides (gentamicin) may be due to the less frequent use of these antibiotics due to less availability, cost and toxic effect respectively. In our study, seventeen isolates were found to be MRSA, indicating a low risk situation for total chronic wound patients. However, it is known that the risk is high in MRSA colonized patients. As a result of the antibiotic susceptibility analysis of S. aureus, the highest antibiotic resistance was found to Tetracycline, Erythromycin and Gentamicin. In addition, the highest susceptibility was found for Vancomycin. When evaluated with the above antibiotic resistance rates, it was seen that there were differences and it was important to perform antibiogram testing.

Regarding antibiotic resistance of Gram-negative, the most common isolates, and especially P. aeruginosa, showed a relatively high resistance to most of the antibiotics. Multi-drug resistant isolates of P. aeruginosa, which are simultaneously completely resistant to ampicillin, amoxicillin/clavulanic acid, ertapenem and trimethoprim/sulfamethoxazole, are of great concern. In addition, the results show that P. aeruginosa tends to show a high level of resistance to carbapenems and third-generation cephalosporines. However, P. mirabilis and E. coli showed a low resistance profile compared to P. aeruginosa. In the study by Mama et al. (27), P. aeruginosa showed decreased susceptibility to commonly used antibiotics such as ampicillin, doxycycline, naldixic acid and tetracycline, except ciprofloxacin, norfloxacin (100%) and gentamicin (82%). Ciprofloxacin and norfloxacin were reported to be the most potent oral drugs available for the treatment of P. aeruginosa infections. This report is in agreement with the result of another study in which ciprofloxacin recorded the least resistance (6.2-24%) to P. aeruginosa isolates from wound infection (47). Currently, there is no doubt that the oral drug ciprofloxacin and injection gentamicin are the most effective antibiotics for P. aeruginosa involved in wound infection compared to many other commonly used drugs. Third generation cephalosporines (ceftriaxone 63.6%) are a real cure for resistant Pseudomonas. In fact, irrational and inappropriate use of antibiotics is responsible for the development of resistance of Pseudomonas to antibiotic monotherapy. The incidence of P. aeruginosa in wound infection in hospitalized patients is becoming more serious in developing countries due to the lack of general hygiene conditions, production of low-quality antiseptics and medical solutions for treatment (29). In our study, antibiotic susceptibility analysis of P. aeruginosa strains showed the highest resistance to cefoxitin, cefazolin and cefepime. In addition, resistance to colistin was found to be at the lowest rate. Again, carbapenem resistance was determined among P. aeruginosa strains, although it was not high. P. aeruginosa isolated from patients with chronic wounds showed multidrug resistance and this posed a risk.

Conclusion

In our hospital, S. aureus and P. aeruginosa were found to be the most common bacterial agents in patients with chronic wounds. Since these bacteria may have multidrug resistance, it was determined that it is very important to perform antibiogram tests. Vancomycin and colistin can be used effectively in wound infections. It was revealed that improving the part of hospital surveillance related to wound infections would contribute to treatment.

References

1. Meaume S, Keriheul JC, Fromantin I, T´eot L. Workload and prevalence of open wounds in the community: French Vulnus initiative. J Wound Care 2012;21:62–6.
2. Cooper R, Lawrence JC. The isolation and identification of bacteria from wounds. J Wound Care 1996;5:335–40.
3. Edwards R, Harding KG. Bacteria and wound healing. Curr Opin Infect Dis 2004;17:91–6.
4. Gjødsbøl K, Christensen JJ, Karlsmark T, et al. Multiple bacterial species reside in chronic wounds: a longitudinal study. Int Wound J 2006;3(3):225-31
5. Serra R, Grande R, Butrico L, et al. Skin grafting and topical application of platelet gel in the treatment of vascular lower extremity ulcers. Acta Phlebol 2014;15(3): 129-36
6. Skerritt L, Moore Z. The prevalence, aetiology and management of wounds in a community care area in Ireland. Br J Community Nurs 2014(Suppl):S11-17
7. Pannier F, Rabe E. Differential diagnosis of leg ulcers. Phlebology 2013;28(Suppl 1): 55-60
8. Wang T, Feng Y, Sun H, et al. miR-21 regulates skin wound healing by targeting multiple aspects of the healing process. Am J Pathol 2012;181(6):1911-20
9. Johnson KE, Wilgus TA. Vascular endothelial growth factor and angiogenesis in the regulation of cutaneous wound repair. Adv Wound Care (New Rochelle) 2014;3(10):647-61.
10. Serra R, Buffone G, Costanzo G, et al. Altered Metalloproteinase-9 expression as the least common denominator between Varicocele, Inguinal Hernia and Chronic Venous Disorders. Ann Vasc Surg 2014; 28(3):705-9
11. Serra R, Gallelli L, Conti A, et al. The effects of Sulodexide on both clinical and molecular parameters in patients with mixed arterial and ulcers of lower limbs. Drug Des Devel Ther 2014;8:1-9
12. Kim BK, Lee YK, Park KY, et al. Analysis of multiple risk factors affecting the result of free flap transfer for necrotisingsoft tissue defects of the lower extremities in patients with type 2 diabetes mellitus. J Plast Reconstr Aesthet Surg 2014;67(5):624-8
13. Wysocki AB, Bhalla-Regev SK, Tierno PM Jr, et al. Proteolytic activity by multiple bacterial species isolated from chronic venous leg ulcers degrades matrix substrates. Biol Res Nurs 2013;15(4):407-15
14. Renner R, Sticherling M, Ru¨ger R, Simon J. Persistence of bacteria like Pseudomonas aeruginosa in non-healing venous ulcers. Eur J Dermatol 2012;22(6):751-7
15. Storm-Versloot MN, Vos CG, Ubbink DT, Vermeulen H. T opical silver for preventing wound infection. Cochrane Database Syst Rev 2010(3):CD006478
16. Nelson EA, O’Meara S, Golder S, DASIDU Steering Group. Systematic review of antimicrobial treatments for diabetic foot ulcers. Diabet Med 2006;23(4):348-59
17. Chow I, Lemos EV, Einarson TR. Management and prevention of diabetic foot ulcers and infections: a health economic review. Pharmacoeconomics 2008; 26(12):1019-35
18. Fazli M, Bjarnsholt T, Kirketerp-Møller K, et al. Nonrandom distribution of Pseudomonas aeruginosa and Staphylococcus aureus in chronic wounds. J Clin Microbiol 2009;47(12):4084-9
19. Malic S, Hill KE, Hayes A, et al. Detection and identification of specific bacteria in wound biofilms using peptide nucleic acid fluorescent in situ hybridization (PNA FISH). Microbiology 2009;155(Pt 8): 2603-11
20. Forster AJ, Oake N, Roth V, et al. Patient-level factors associated with methicillin-resistant Staphylococcus aureus carriage at hospital admission: a systematic review. Am J Infect Control 2013;41(3): 214-20
21. Schmidtchen A, Wolff H, Hansson C. Differential proteinase expression by Pseudomonas aeruginosa derived from chronic leg ulcers. Acta Derm Venereol 2001;81(6):406-9
22. Vatcheva-Dobrevska R, Mulet X, Ivanov I, et al. Molecular epidemiology and multidrug resistance mechanisms of Pseudomonas aeruginosa isolates from Bulgarian hospitals. Microb Drug Resist 2013;19(5):355-61
23. De Leon S, Clinton A, Fowler H, et al. Synergistic Interactions of pseudomonas aeruginosa and staphylococcus aureus in an in vitro wound Model. Infect Immun 2014; 82(11):4718-28
24. Pastar I, Nusbaum AG, Gil J, et al. Interactions of Methicillin Resistant Staphylococcus aureus USA300 and Pseudomonas aeruginosa in Polymicrobial Wound Infection. PLoS One 2013;8(2): 1-11
25. Stegger, Á., Andersen, P. S., Kearns, A., Pichon, B., Holmes, M. A., Edwards, G., ... & Larsen, A. R. (2012). Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecALGA251. Clinical Microbiology and Infection, 18(4), 395-400.
26. Pitout, J. D., Gregson, D. B., Poirel, L., McClure, J. A., Le, P., & Church, D. L. (2005). Detection of Pseudomonas aeruginosa producing metallo-β-lactamases in a large centralized laboratory. Journal of Clinical Microbiology, 43(7), 3129-3135.
27. Mama, M., Abdissa, A., & Sewunet, T. (2014). Antimicrobial susceptibility pattern of bacterial isolates from wound infection and their sensitivity to alternative topical agents at Jimma University Specialized Hospital, South-West Ethiopia. Annals of clinical microbiology and antimicrobials, 13(1), 1-10.
28. Taye M: Wound infection in Tikur Anbessa hospital, surgical department. Ethiop Med J 2005, 43(3):167–174.
29. Goswami N, Trivedi HR, Goswami APP: Antibiotic sensitivity profile of bacterial pathogens in Postoperative wound infections at a tertiary care hospital in Gujarat, India. J Pharm Pharm 2011, 2(3):158–164.
30. Bowler PG, Davies BJ. The microbiology of infected and noninfected leg ulcers. Int J Dermatol 1999;38:573–8.
31. Körber A, Schmid EN, Buer J, Klode J, Schadendorf D, Dissemond J. Bacterial colonization of chronic leg ulcers: current results compared with data 5 years ago in a specialized dermatology department. J Eur Acad Dermatol Venereol 2010;24:1017–25.
32. Suchitra JB, Lakshmidevi N: Surgical site infections: assessing risk factors, outcomes and antimicrobial sensitivity patterns. Afr J Microbiol Res 2009, 3(4):175–179.
33. Basu S, Ramchuran PT, Bali ST, Gulati A, Shukla V: A prospective, descriptive study to identify the microbiological profile of chronic wounds in outpatients. Ostomy Wound Manage 2009, 55(1):14–20.
34. Burmølle M, Thomsen TR, Fazli M, Dige I, Christensen L, Homøe P, Tvede M, Nyvad B, Tolker-Nielsen T, Givskov M, Moser C, Kirketerp-Møller K, Johansen HK, Høiby N, Jensen PØ, Sørensen SJ, Bjarnsholt T. Biofilms in chronic infections – a matter of opportunity–monospecies biofilms in multispecies infections. FEMS Immunol Med Microbiol 2010;59:324–36.
35. Dissemond J. Methicillin resistant Staphylococcus aureus (MRSA): diagnostic, clinical relevance and therapy. J Dtsch Dermatol Ges 2009;6:544–51.
36. Schmidtchen A, Holst E, Tapper H, Bjorck L. Elastase-producing Pseudomonas aeruginosa degrade plasma proteins and extracellular products of human skin and fibroblasts, and inhibit fibroblast growth. Microb Pathog 2003;34:47–55.
37. Percival SL, Thomas JG,Williams DW. Biofilms and bacterial imbalances in chronic wounds: anti-Koch. Int Wound J 2010;7:169–75.
38. Bhatt C, Lakhey M: The distribution of pathogens causing wound infection and their antibiotic susceptibility pattern. J Nepal Health Res Council 2006, 5(1):22–26.
39. Emele F, Izomoh M, Alufohai E: Microorganisms Associated With Wound Infection In Ekpoma. Nigeria. West Afr J Med 1999, 18(2):97–100.
40. Howell-Jones RS, Wilson MJ, Hill KE, Howard AJ, Price PE, Thomas DW. A review of the microbiology, antibiotic usage and resistance in chronic skin wounds. J Antimicrob Chemother 2005; 55:143–9.
41. Demling RH, Waterhouse B. The increasing problem of wound bacterial burden and infection in acute and chronic soft-tissue wounds caused by methicillin-resistant Staphylococcus aureus. J Burns wounds 2007;7:86–98.
42. Mulu W, Kibru G, Beyene G, Damtie M: Postoperative nosocomial infections and antimicrobial resistance pattern of bacteria isolates among patients admitted at Felege Hiwot Referral Hospital, Bahirdar. Ethiopia Ethiop J Health Sci 2012, 22(1):7–18.
43. Manikandan C, Amsath A: Antibiotic susceptibility of bacterial strains isolated from wound infectionpatients in Pattukkottai, Tamilnadu, India. Int J Curr Microbiol App Sci 2013, 2(6):195–203.
44. Abraham Y, Wamisho BL: Microbial susceptibility of bacteria isolated from open fracture wounds presenting to the err of black-lion hospital, Addis Ababa University, Ethiopia. Afr J Microbiol Res 2009, 3(12):939–951.
45. Suchitra JB, Lakshmidevi N: Surgical site infections: assessing risk factors, outcomes and antimicrobial sensitivity patterns. Afr J Microbiol Res 2009, 3(4):175–179.
46. Islam MA, Alam MM, Choudhury ME, Kobayashi N, Ahmed MU: Determination of minimum inhibitory concentration (MIC) ofcloxacillin for selected isolates of methicillin resistant Staphylococcus aureus (MRSA) with their antibiogram. Bangl J Vet Med 2008, 6(1):121–126.
47. Mulu W, Kibru G, Beyene G, Damtie M: Postoperative nosocomial infections and antimicrobial resistance pattern of bacteria isolates among patients admitted at Felege Hiwot Referral Hospital, Bahirdar. Ethiopia Ethiop J Health Sci 2012, 22(1):7–18.